A global overview of drought and heat-induced tree mortality reveals emerging climate change risks for forests. Forest Ecology and Management, pp.660-684, 2010. ,
Chloroplasts: formation of active oxygen and its scavenging, Methods in enzymology, 1984. ,
agris.fao.org/agris-search/search.do? Les effets de l'ozone sur les processus foliaires du peuplier : une approche protéomique, 2010. ,
Detoxification and repair process of ozone injury: From O3 uptake to gene expression adjustment. Environmental Pollution, 2009. ,
Comparative transcriptomics of drought responses in Populus: a meta-analysis of genome-wide expression profiling in mature leaves and root apices across two genotypes. BMC genomics, p.630, 2010. ,
URL : https://hal.archives-ouvertes.fr/inserm-00663875
Detection of Hydrogen Peroxide by DAB Staining in Arabidopsis Leaves. Bio-protocol. 9 février 2012 Disponible à l'adresse : http://www.bioprotocol .org/wenzhang.aspx? Redox homeostasis in plants. The challenge of living with endogenous oxygen production, Respiratory Physiology & Neurobiology. août, vol.173, pp.13-19, 2010. ,
Capacity for NADPH regeneration in the leaves of two poplar genotypes differing in ozone sensitivity, Physiologia Plantarum, 2012. ,
URL : https://hal.archives-ouvertes.fr/hal-01268117
Could the differences in O3 sensitivity between two poplar clones be related to a difference in antioxidant defense and secondary metabolic response to O3 influx?, Tree Physiology, vol.28, issue.12, pp.12-1761, 2008. ,
DOI : 10.1093/treephys/28.12.1761
Does glutathione metabolism have a role in the defence of poplar against zinc excess?, New Phytologist, vol.10, issue.1, pp.73-80, 2005. ,
DOI : 10.1093/treephys/24.1.75
Reactions of Norway spruce and beech trees to 2 years of ozone exposure and episodic drought. Environmental and Experimental Botany, 1998. ,
Rôle de la régulation stomatique et de la capacité de détoxication foliaire dans l'estimation d'un seuil de risque à l'ozone pour la végétation, 2013. ,
Ozone affects ascorbate and glutathione biosynthesis as well as amino acid contents in three Euramerican poplar genotypes. Tree physiology, pp.253-266, 2014. ,
URL : https://hal.archives-ouvertes.fr/hal-01555992
Generation and scavenging of reactive oxygen species in chloroplasts: a submolecular approach Agriculture, Ecosystems & Environment, 2005. ,
, , 2006.
, Physiologia Plantarum, vol.127, issue.1, pp.57-65, 2006.
The presence of glutathione and glutathione reductase in chloroplasts: a proposed role in ascorbic acid metabolism, Planta, vol.133, issue.1, pp.21-25, 1976. ,
Ascorbate and glutathione: the heart of the redox hub. Plant Physiology, pp.2-18, 2011. ,
The lack of a systematic validation of reference genes: a serious pitfall undervalued in reverse transcriptionpolymerase chain reaction (RT-PCR) analysis in plants, Plant biotechnology journal, vol.6, issue.6, pp.609-618, 2008. ,
Role of free radicals and catalytic metal ions in human disease: an overview. Methods in enzymology, pp.1-85, 1989. ,
Inactivation of ascorbate peroxidase in spinach chloroplasts on dark addition of hydrogen peroxide: it's protection by ascorbate. Plant and cell physiology, pp.1285-1295, 1984. ,
Climate Change 2013: The Physical Science Basis. Contribution of Working Group I to the Fifth Assessment Report of the Intergovern-mental Panel on Climate Change, IPCC, p.1535, 2013. ,
Oxidative Stress, the Paradigm of Ozone Toxicity in Plants and Animals. Water, Air, and Soil Pollution. 29 novembre, pp.1-4, 2007. ,
Effects of ozone and mild drought stress on gas exchange, antioxidants and chloroplast pigments in currentyear needles of young Norway spruce, pp.482-489, 1998. ,
Ozone Concentration in Leaf Intercellular Air Spaces Is Close to Zero 1. Plant Physiology, pp.1163-1167, 1989. ,
Forests under climate change and air pollution: Gaps in understanding and future directions for research Environmental Pollution, 2012. ,
Impact of drought on productivity and water use efficiency in 29 genotypes of Populus deltoides x Populus nigra, pp.765-777, 2006. ,
Recent tropospheric ozone changes?A pattern dominated by slow or no growth Atmospheric Environment, pp.331-351, 2013. ,
Drought tolerance in relation to protection against oxidative stress in clones of Coffea canephora subjected to long-term drought. Plant science, pp.1307-1314, 2004. ,
Severe drought events increase the sensitivity to ozone on poplar clones, Environmental and Experimental Botany, vol.100, pp.94-104, 2014. ,
Missing links in understanding redox signaling via thiol/disulfide modulation: how is glutathione oxidized in plants? Frontiers in Plant Science, 2013. ,
, , 1999.
, The Decay of O3 through Direct Reaction with Cell Wall Ascorbate is not Sufficient to Explain the Different Degrees of O3-sensitivity in two Poplar Clones, Journal of Plant Physiology. février, vol.154, issue.299, pp.250-255, 1999.
Drought tolerance of two black poplar (Populus nigra L.) clones: contribution of carbohydrates and oxidative stress defence, Plant, Cell & Environment. décembre, vol.32, issue.12, pp.1724-1736, 2009. ,
Functional divergence and catalytic properties of dehydroascorbate reductase family proteins from Populus tomentosa Molecular biology reports, pp.5105-5114, 2013. ,
Defense and avoidance of ozone under global change. Environmental Pollution. juin, pp.525-531, 2007. ,
Influence of drought stress on the cellular ultrastructure and antioxidant system in leaves of drought-tolerant and drought-sensitive apple rootstocks, Plant Physiology and Biochemistry. 2012, vol.51, pp.81-89, 2012. ,
Quantifying the impact of current and future tropospheric ozone on tree biomass, growth, physiology and biochemistry: a quantitative meta-analysis, Global Change Biology. février, vol.15, issue.2, pp.396-424, 2009. ,
Responses to drought stress in two poplar species originating from different altitudes, Biologia Plantarum, vol.53, issue.3, pp.511-516, 2009. ,
Cytosolic dehydroascorbate reductase is important for ozone tolerance in Arabidopsis thaliana, Plant Cell Physiol, vol.47, issue.2, pp.304-308, 2006. ,
, , p.33
,
,
, , 0120.
,
,
, , 125100-01-80.
,
, , 2001.
,
,
, , 2001.
,
008G049300 . l 250 ~otrt, 2001. ,
, , p.360
,
,
,
,
,
,
,
, , p.313
uklTuoiSts~:rvict'3lwebltoo1resu!Lebi"joQid"d~ , ~c!.>o~iloo.h. ~ctu.ctz> ,
,
,
N\ATGTCCACTGCMGMTCC -·TCACCTGTCACCAA1?CCTACG-ATTCACTCTCTCGG7CTCTACOCCOGTCAACCTTT ,
,
,
, CTGCTGTTGCTGCOCCTMTATTCTOGGAGATTGCCCATTTTGCCAGAGAGTTCTGTTGA
,
,
,
, , p.53
<aiW:! -EMBL-EBI ~ocr1, pp.2-3 ,
,
, , 2001.
, , 2001.
, , p.550
,
,
, , p.610
,
, , 1920.
,
, , 2001.
,
,
, , p.613
,
,
, , 2001.
,
,
, , 2001.
,
,
, , p.784
,
,
, , 2001.
, http:, 1 'www.ebi.ae.uk/Tools:'servicts.'weblwolresult:bi?jobldaclus
,
, , 1080.
,
, , p.843
, , 1140.
,
, , 2001.
,
,
, , p.889
,
,
,
, , 2001.
,
, , 2001.
, , 2001.
,
, , 2001.
,
, , 1126.
,
, , 2001.
,
, , 1080.
,
, 1S60 Potr1
, , 1111.
, , 2001.
, ok Too1sJ$('Niccs .? webJtoolre>utLt ni~jobfd-clus
,
A.r;AAAC'i"TAAAGAAA TGG<:CTTGAAACTAAATATAATTTTTCTTTCAC"M ,
, TTTTTTATGATTTGTTGTCTTGGTAAGTATAGTTCTTTGCCTAGTGC7CATATGAAAGAA
,
,
, CGTTTTGTGTTGTTTTGTTTTTTATTTTCGTTTTTAATGTGAGGAOG7TCTGCAACTTCA
, CAAGGAAGATGGAAGCCTCTTCATCCATCGATCTCTTGAAGAACCATGGATATGTGTATC
, AAGCTTTCCTCCATGAATTCAACATGTCCAAGGGCACAAAAGCAAACATGACATCTACTG, vol.21, issue.19, p.53
, f\IBL·EBI Potrt.008G049JOO.l Po~rl, 2001.
,
, 008G?49JOO.l Potr1.010G2ll600.l 1220 Pot
,
,
, , p.1202
010C211600.l :nt Potr:.017Gl2~100 ,
, l8l0 Potr1
, , 2001.
, , 2001.
,
, GTTCTCCTCTTT'M'CTCTT 181i PLEASE NOTE: Showing co/ors on 18rge a