A. Bibliographiques, C. Macalady, A. Chenchouni, H. Bachelet, D. Mcdowell et al., A global overview of drought and heat-induced tree mortality reveals emerging climate change risks for forests. Forest Ecology and Management, pp.660-684, 2010.

A. and K. , Chloroplasts: formation of active oxygen and its scavenging, Methods in enzymology, 1984.

B. Disponible-À-l-'adresse and S. , agris.fao.org/agris-search/search.do? Les effets de l'ozone sur les processus foliaires du peuplier : une approche protéomique, 2010.

C. , A. Et, R. , and A. , Detoxification and repair process of ozone injury: From O3 uptake to gene expression adjustment. Environmental Pollution, 2009.

C. , D. Bogeat-triboulot, M. Tisserant, E. Balzergue, S. Martin-magniette et al., Comparative transcriptomics of drought responses in Populus: a meta-analysis of genome-wide expression profiling in mature leaves and root apices across two genotypes. BMC genomics, p.630, 2010.
URL : https://hal.archives-ouvertes.fr/inserm-00663875

D. , A. Et-o-'brien, A. , D. Gara, L. Locato et al., Detection of Hydrogen Peroxide by DAB Staining in Arabidopsis Leaves. Bio-protocol. 9 février 2012 Disponible à l'adresse : http://www.bioprotocol .org/wenzhang.aspx? Redox homeostasis in plants. The challenge of living with endogenous oxygen production, Respiratory Physiology & Neurobiology. août, vol.173, pp.13-19, 2010.

D. , A. Dumont, J. Hasenfratz-sauder, M. Dizengremel, P. Le-thiec et al., Capacity for NADPH regeneration in the leaves of two poplar genotypes differing in ozone sensitivity, Physiologia Plantarum, 2012.
URL : https://hal.archives-ouvertes.fr/hal-01268117

D. Baccio, D. Castagna, A. Paoletti, E. Sebastiani, L. Et et al., Could the differences in O3 sensitivity between two poplar clones be related to a difference in antioxidant defense and secondary metabolic response to O3 influx?, Tree Physiology, vol.28, issue.12, pp.12-1761, 2008.
DOI : 10.1093/treephys/28.12.1761

D. Baccio, D. Kopriva, S. Sebastiani, L. Rennenberg, and H. , Does glutathione metabolism have a role in the defence of poplar against zinc excess?, New Phytologist, vol.10, issue.1, pp.73-80, 2005.
DOI : 10.1093/treephys/24.1.75

D. , M. Le-thiec, D. Et, G. , and J. , Reactions of Norway spruce and beech trees to 2 years of ozone exposure and episodic drought. Environmental and Experimental Botany, 1998.

D. and J. , Rôle de la régulation stomatique et de la capacité de détoxication foliaire dans l'estimation d'un seuil de risque à l'ozone pour la végétation, 2013.

D. , J. Keski-saari, S. Keinänen, M. Cohen, D. Ningre et al., Ozone affects ascorbate and glutathione biosynthesis as well as amino acid contents in three Euramerican poplar genotypes. Tree physiology, pp.253-266, 2014.
URL : https://hal.archives-ouvertes.fr/hal-01555992

E. and A. , Generation and scavenging of reactive oxygen species in chloroplasts: a submolecular approach Agriculture, Ecosystems & Environment, 2005.

E. , A. Kawano, N. Badawi, G. Kaminaka, H. Sanekata et al., , 2006.

, Physiologia Plantarum, vol.127, issue.1, pp.57-65, 2006.

F. , C. Et, H. , and B. , The presence of glutathione and glutathione reductase in chloroplasts: a proposed role in ascorbic acid metabolism, Planta, vol.133, issue.1, pp.21-25, 1976.

F. , C. Et, N. , and G. , Ascorbate and glutathione: the heart of the redox hub. Plant Physiology, pp.2-18, 2011.

G. , L. Mauriat, M. Guénin, S. Pelloux, J. Lefebvre et al., The lack of a systematic validation of reference genes: a serious pitfall undervalued in reverse transcriptionpolymerase chain reaction (RT-PCR) analysis in plants, Plant biotechnology journal, vol.6, issue.6, pp.609-618, 2008.

H. , B. Et, G. , and J. , Role of free radicals and catalytic metal ions in human disease: an overview. Methods in enzymology, pp.1-85, 1989.

H. , M. Et, A. , and K. , Inactivation of ascorbate peroxidase in spinach chloroplasts on dark addition of hydrogen peroxide: it's protection by ascorbate. Plant and cell physiology, pp.1285-1295, 1984.

S. , T. F. , D. Qin, G. Plattner, M. Tignor et al., Climate Change 2013: The Physical Science Basis. Contribution of Working Group I to the Fifth Assessment Report of the Intergovern-mental Panel on Climate Change, IPCC, p.1535, 2013.

I. , M. Et, F. , and F. , Oxidative Stress, the Paradigm of Ozone Toxicity in Plants and Animals. Water, Air, and Soil Pollution. 29 novembre, pp.1-4, 2007.

S. Kronfuß, G. Polle, A. Tausz, M. Havranek, W. M. Et et al., Effects of ozone and mild drought stress on gas exchange, antioxidants and chloroplast pigments in currentyear needles of young Norway spruce, pp.482-489, 1998.

L. , A. Kull, O. Et, M. , and H. , Ozone Concentration in Leaf Intercellular Air Spaces Is Close to Zero 1. Plant Physiology, pp.1163-1167, 1989.

M. , R. Wieser, G. Calfapietra, C. De-vries, W. Dizengremel et al., Forests under climate change and air pollution: Gaps in understanding and future directions for research Environmental Pollution, 2012.

M. , R. Dreyer, E. Villar, M. Delmotte, F. M. Delay et al., Impact of drought on productivity and water use efficiency in 29 genotypes of Populus deltoides x Populus nigra, pp.765-777, 2006.

O. , S. J. Lefohn, A. S. Shadwick, D. Harris, J. M. Scheel et al., Recent tropospheric ozone changes?A pattern dominated by slow or no growth Atmospheric Environment, pp.331-351, 2013.

P. , H. Damatta, F. Chaves, A. Fontes, E. Et et al., Drought tolerance in relation to protection against oxidative stress in clones of Coffea canephora subjected to long-term drought. Plant science, pp.1307-1314, 2004.

P. , M. Desotgiu, R. Camin, F. Ziller, L. Gerosa et al., Severe drought events increase the sensitivity to ozone on poplar clones, Environmental and Experimental Botany, vol.100, pp.94-104, 2014.

R. , M. Tuzet, A. Mhamdi, A. Et, N. et al., Missing links in understanding redox signaling via thiol/disulfide modulation: how is glutathione oxidized in plants? Frontiers in Plant Science, 2013.

R. , A. Castagna, A. Padu, E. Moldau, H. Rahi et al., , 1999.

, The Decay of O3 through Direct Reaction with Cell Wall Ascorbate is not Sufficient to Explain the Different Degrees of O3-sensitivity in two Poplar Clones, Journal of Plant Physiology. février, vol.154, issue.299, pp.250-255, 1999.

R. , N. Streb, S. Cocozza, C. Schaub, M. Cherubini et al., Drought tolerance of two black poplar (Populus nigra L.) clones: contribution of carbohydrates and oxidative stress defence, Plant, Cell & Environment. décembre, vol.32, issue.12, pp.1724-1736, 2009.

T. , Z. , Y. , and H. , Functional divergence and catalytic properties of dehydroascorbate reductase family proteins from Populus tomentosa Molecular biology reports, pp.5105-5114, 2013.

T. , M. Grulke, N. Et, W. , and G. , Defense and avoidance of ozone under global change. Environmental Pollution. juin, pp.525-531, 2007.

W. , S. Liang, D. Li, C. Hao, Y. Ma et al., Influence of drought stress on the cellular ultrastructure and antioxidant system in leaves of drought-tolerant and drought-sensitive apple rootstocks, Plant Physiology and Biochemistry. 2012, vol.51, pp.81-89, 2012.

W. , V. Ainsworth, E. Naidu, S. Karnosky, D. Et et al., Quantifying the impact of current and future tropospheric ozone on tree biomass, growth, physiology and biochemistry: a quantitative meta-analysis, Global Change Biology. février, vol.15, issue.2, pp.396-424, 2009.

Y. , F. Xu, X. Xiao, X. Et, L. et al., Responses to drought stress in two poplar species originating from different altitudes, Biologia Plantarum, vol.53, issue.3, pp.511-516, 2009.

Y. , S. Tamaoki, M. Shikano, T. Nakajima, N. Ogawa et al., Cytosolic dehydroascorbate reductase is important for ozone tolerance in Arabidopsis thaliana, Plant Cell Physiol, vol.47, issue.2, pp.304-308, 2006.

. Potrl and . Olog211600, , p.33

. Potr~,

P. ,

~. Potri, , 0120.

. Potri,

. Potri,

. Potri, , 125100-01-80.

. Potri,

. Potrt, , 2001.

. Potri and . Ol1gl2sl00,

. Potri,

. Potri, , 2001.

1. Potri and . Ol7c12sl00,

. Potr~, 008G049300 . l 250 ~otrt, 2001.

. Potr~, , p.360

. Potri,

. Potri,

P. ,

. Potri,

P. ,

. Potr~,

. Potr~,

<. Potti and . Ologllléoo, , p.313

. Jc, uklTuoiSts~:rvict'3lwebltoo1resu!Lebi"joQid"d~ , ~c!.>o~iloo.h. ~ctu.ctz>

C. ,

M. ,

A. A. , N\ATGTCCACTGCMGMTCC -·TCACCTGTCACCAA1?CCTACG-ATTCACTCTCTCGG7CTCTACOCCOGTCAACCTTT

A. and A. ,

C. ··acaativ\atacaccaccacaccaocg@bulletgtcact·-acctcactg7ttcaatgtccgc-'l-'acm-'cact-'rtctcmcctcttgaa and .. Atc-'tctctcj\mg,

, CTGCTGTTGCTGCOCCTMTATTCTOGGAGATTGCCCATTTTGCCAGAGAGTTCTGTTGA

C. ,

@. , @. @bullet-'@bullet, . J. @bullet, and . Jo,

G. ,

. Ctttooaggmaagaatctgcc-'m-'atgacatgaagtttgttga-'im-'ggggaacaaacctg-agtggt-'ttttggagataagcccggaaggj\aaggtcccagt~ttgatgacaaat-atggttcttggaggtaaaccc&iaaggaaagg-'m-'ccagtgg-'f-'g, . Aaa, and . Tttgatgacam, , p.53

<. Aligrun<nl> and . Clw, <aiW:! -EMBL-EBI ~ocr1, pp.2-3

. Po~ri,

. Potri, , 2001.

. Poeri, , 2001.

. Potri, , p.550

. Potri,

P. ,

. Po~r1 and . 008g049joo, , p.610

. Potri,

. Potri, , 1920.

. Potri,

. Potri, , 2001.

P. ,

P. ,

P. , , p.613

P. ,

. Potri,

. Potri, , 2001.

P. ,

. Potri,

. Potr~, , 2001.

P. ,

. Potri,

. Potri, , p.784

. Potri,

. Potri,

. Potri, , 2001.

, http:, 1 'www.ebi.ae.uk/Tools:'servicts.'weblwolresult:bi?jobldaclus

G. Gggtctcagactctgatgtcattgttgggatcttagaggagaaataccctgagccctctc, G. @bullet, . @bullet-@bullet-@bullet-@bullet, and . @bullet-@bullet,

<. Alip>elll3 and !. Clust, , 1080.

. Sur and . Potri,

9. Potr~, , p.843

. Potri and . Ol7gl2sloo, , 1140.

. Potrt,

. Potrt, , 2001.

. Potri,

. Potri,

. Potrl and . Olog211600, , p.889

. Potri,

. Potri,

. Potd,

. Potri, , 2001.

. Potri,

. Potri, , 2001.

. Potri, , 2001.

. Potri,

. Potri, , 2001.

. Potri and . Ol7gl2~100,

U. , , 1126.

. Potri,

. Potri, , 2001.

. Po~ri,

. Potri, , 1080.

. Potri and . Ol7gl2~100,

, 1S60 Potr1

. Llôo-potri, , 1111.

. Potri, , 2001.

, ok Too1sJ$('Niccs .? webJtoolre>utLt ni~jobfd-clus

A. ,

G. Mcagatgcaattctgtcaccacat and . @bullet·, A.r;AAAC'i"TAAAGAAA TGG<:CTTGAAACTAAATATAATTTTTCTTTCAC"M

, TTTTTTATGATTTGTTGTCTTGGTAAGTATAGTTCTTTGCCTAGTGC7CATATGAAAGAA

T. ,

T. ,

, CGTTTTGTGTTGTTTTGTTTTTTATTTTCGTTTTTAATGTGAGGAOG7TCTGCAACTTCA

, CAAGGAAGATGGAAGCCTCTTCATCCATCGATCTCTTGAAGAACCATGGATATGTGTATC

, AAGCTTTCCTCCATGAATTCAACATGTCCAAGGGCACAAAAGCAAACATGACATCTACTG, vol.21, issue.19, p.53

<. Cl, f\IBL·EBI Potrt.008G049JOO.l Po~rl, 2001.

P. ,

!. C. So-potr1, 008G?49JOO.l Potr1.010G2ll600.l 1220 Pot

P. ,

. Potri,

. Potr1 and . 008g049joo, , p.1202

P. , 010C211600.l :nt Potr:.017Gl2~100

, l8l0 Potr1

. Potrl, , 2001.

. Potri, , 2001.

C. Gaagccagaga1-'tgggttttaccaaaacgcmacc1-'tgattg-!, . Gcaa, and . @bullet,

A. '. Cgta, /. Xa, I. Caccatmcttttmccttcicj, . Iicccatctctttcttctcc-'t-'mtatt-g, . Mcctggactgcattat-~-@bullet@bullet-·ccctcccaca-'m-"-ftcca1-'ttgc-@bullet et al., GTTCTCCTCTTT'M'CTCTT 181i PLEASE NOTE: Showing co/ors on 18rge a