Bone development. Bone, vol.80, pp.14-22, 2015. ,
FGF signaling pathways in endochondral and intramembranous bone development and human genetic disease, Genes Dev, vol.16, issue.12, pp.1446-1465, 2002. ,
Development of the endochondral skeleton, Cold Spring Harb Perspect Biol. 1 janv, vol.5, issue.1, p.8334, 2013. ,
Wnt signaling in cartilage development and diseases: lessons from animal studies, Lab Invest. févr, vol.96, issue.2, pp.186-96, 2016. ,
La culture de chondrocytes : outil d'analyse de la différenciation et de l'organisation moléculaire du cartilage. médecine/sciences, vol.12, p.1087, 1996. ,
Tissue engineering for articular cartilage repair -the state of the art, Eur Cell Mater. 2 mai, vol.25, pp.248-67, 2013. ,
Advantages of exercise in rehabilitation, treatment and prevention of altered morphological features in knee osteoarthritis. A narrative review, Histol Histopathol. juin, vol.29, issue.6, pp.707-726, 2014. ,
Mechano-Electrochemical Properties Of Articular Cartilage: Their Inhomogeneities and Anisotropies, Annu Rev Biomed Eng. août, vol.4, issue.1, pp.175-209, 2002. ,
The composition of normal and osteoarthritic articular cartilage from human knee joints. With special reference to unicompartmental replacement and osteotomy of the knee, J Bone Joint Surg Am. janv, vol.66, issue.1, pp.95-106, 1984. ,
Cartilage Derived from Bone Marrow Mesenchymal Stem Cells Expresses Lubricin In Vitro and, In Vivo. Serra R, éditeur. PLOS ONE. 11 févr, vol.11, issue.2, p.148777, 2016. ,
Biphasic material properties articular cartilage compressioon experiments, vol.8, 1997. ,
Morphology and biochemistry of the growth plate, Rheum Dis Clin North Am. avr, vol.13, issue.1, pp.75-100, 1987. ,
Growth plate physiology and pathology, Orthop Clin North Am. janv, vol.21, issue.1, pp.1-17, 1990. ,
Embryologie Humaine de larsen, 2017. ,
Manipulating the Mouse Embryo : A laboratory Manual ,
A pathway to bone: signaling molecules and transcription factors involved in chondrocyte development and maturation, Development. 1 mars, vol.142, issue.5, pp.817-848, 2015. ,
Remodeling potential of long bones following angular osteotomies, J Pediatr Orthop. févr, vol.9, issue.1, pp.37-43, 1989. ,
Effects of distraction and compression on proliferation of growth plate chondrocytes. A study in rabbits, Acta Orthop Scand. août, vol.64, issue.4, pp.449-55, 1993. ,
Mechanism of longitudinal bone growth and its regulation by growth plate chondrocytes, Microsc Res Tech. 15 août, vol.28, issue.6, pp.505-524, 1994. ,
Bone growth in length and width: the Yin and Yang of bone stability, J Musculoskelet Neuronal Interact. sept, vol.5, issue.3, pp.194-201, 2005. ,
Control of Bone Growth in Rats, Nature. févr, vol.229, issue.5284, p.428, 1971. ,
Linear relationship between the volume of hypertrophic chondrocytes and the rate of longitudinal bone growth in growth plates, J Orthop Res, vol.9, issue.3, pp.348-59, 1991. ,
Determinants of Spatial Polarity in the Growth Plate, Endocrinology. 1 févr, vol.140, issue.2, pp.958-62, 1999. ,
The Role of the Resting Zone in Growth Plate Chondrogenesis, Endocrinology. 1 mai, vol.143, issue.5, pp.1851-1858, 2002. ,
Sox9 is required for cartilage formation, Nat Genet. mai, vol.22, issue.1, pp.85-94, 1999. ,
From head to toes: the multiple facets of Sox proteins, Nucleic Acids Res. 15 mars, vol.27, issue.6, pp.1409-1429, 1999. ,
Campomelic dysplasia and autosomal sex reversal caused by mutations in an SRYrelated gene, Nature. 8 déc, vol.372, issue.6506, pp.525-555, 1994. ,
Autosomal sex reversal and campomelic dysplasia are caused by mutations in and around the SRY-related gene SOX9, Cell. 16 déc, vol.79, issue.6, pp.1111-1131, 1994. ,
Related Peptide Receptor Causing Blomstrand Lethal Osteochondrodysplasia, J Clin Endocrinol Metab, vol.84, issue.10, pp.3713-3733, 1999. ,
A constitutively active mutant PTH-PTHrP receptor in Jansen-type metaphyseal chondrodysplasia, Science. 7 avr, vol.268, issue.5207, pp.98-100, 1995. ,
Constitutively Activated Receptors for Parathyroid Hormone and Parathyroid Hormone-Related Peptide in Jansen's Metaphyseal Chondrodysplasia, N Engl J Med. 5 sept, vol.335, issue.10, pp.708-722, 1996. ,
The PTH/PTHrP Receptor Can Delay Chondrocyte Hypertrophy In Vivo without Activating Phospholipase C, Dev Cell. 1 août, vol.3, issue.2, pp.183-94, 2002. ,
The chondrogenic transcription factor Sox9 is a target of signaling by the parathyroid hormone-related peptide in the growth plate of endochondral bones, Proc Natl Acad Sci, vol.98, issue.1, pp.160-165, 2001. ,
Signaling from Smo to Ci/Gli: conservation and divergence of Hedgehog pathways from Drosophila to vertebrates, Development. 1 janv, vol.133, issue.1, pp.3-14, 2006. ,
Hedgehog signaling in animal development: paradigms and principles, Genes Dev. 12 janv, vol.15, issue.23, pp.3059-87, 2001. ,
Developmental roles and clinical significance of Hedgehog signaling, Current Topics in Developmental Biology, pp.1-114, 2003. ,
Direct requirement for Ihh signaling in chondrocyte proliferation, vol.10, 2001. ,
Tamoxifen-inducible gene deletion reveals a distinct cell type associated with trabecular bone, and direct regulation of PTHrP expression and chondrocyte morphology by Ihh in growth region cartilage, Dev Biol. 1 août, vol.308, issue.1, pp.93-105, 2007. ,
Indian hedgehog stimulates periarticular chondrocyte differentiation to regulate growth plate length independently of PTHrP, J Clin Invest, vol.115, issue.7, pp.1734-1776, 2005. ,
Indian hedgehog coordinates endochondral bone growth and morphogenesis via parathyroid hormone related-protein-dependent and -independent pathways, Development. 1 févr, vol.127, issue.3, pp.543-551, 2000. ,
PTHrP and Skeletal Development, Ann N Y Acad Sci. 1 avr, vol.1068, issue.1, pp.1-13, 2006. ,
Ihh controls cartilage development by antagonizing Gli3, but requires additional effectors to regulate osteoblast and vascular development, Development, vol.132, pp.4339-51, 2005. ,
Gli3 acts as a repressor downstream of Ihh in regulating two distinct steps of chondrocyte differentiation, Development. 1 déc, vol.132, issue.23, pp.5249-60, 2005. ,
Structure du récepteur Smoothened. médecine/sciences, vol.29, pp.855-60, 2013. ,
FGFR3 signaling induces a reversible senescence phenotype in chondrocytes similar to oncogene-induced premature senescence, Bone. juill, vol.47, issue.1, pp.102-112, 2010. ,
The FGF family: biology, pathophysiology and therapy, Nat Rev Drug Discov. mars, vol.8, issue.3, pp.235-53, 2009. ,
Hormone-like (endocrine) Fgfs: their evolutionary history and roles in development, metabolism, and disease, Cell Tissue Res, vol.342, issue.1, pp.1-11, 2010. ,
Functional evolutionary history of the mouse Fgf gene family, Dev Dyn, vol.237, issue.1, pp.18-27, 2008. ,
Fibroblast growth factors: from molecular evolution to roles in development, metabolism and disease, J Biochem (Tokyo). 1 févr, vol.149, issue.2, pp.121-151, 2011. ,
Evolution of the FGF Gene Family, Int J Evol Biol, p.298147, 2012. ,
Morphology and physiology of the epiphyseal growth plate, Folia Histochem Cytobiol, vol.47, issue.1, pp.5-16, 2009. ,
Isoforms of receptors of fibroblast growth factors, J Cell Physiol. déc, vol.229, issue.12, pp.1887-95, 2014. ,
Fibroblast growth factors, their receptors and signaling, Endocr Relat Cancer. 1 sept, vol.7, issue.3, pp.165-97, 2000. ,
Mechanisms underlying differential responses to FGF signaling, Cytokine Growth Factor Rev. avr, vol.16, issue.2, pp.233-280, 2005. ,
The Fibroblast Growth Factor signaling pathway, Wiley Interdiscip Rev Dev Biol. mai, vol.4, issue.3, pp.215-66, 2015. ,
Role of FGFs/FGFRs in skeletal development and bone regeneration, J Cell Physiol, vol.227, issue.12, pp.3731-3774, 2012. ,
Bisindolylmaleimide I Suppresses Fibroblast Growth Factor-mediated Activation of Erk MAP Kinase in Chondrocytes by Preventing Shp2 Association with the Frs2 and Gab1 Adaptor Proteins, J Biol Chem. 2 févr, vol.282, issue.5, pp.2929-2965, 2007. ,
FGF-2: apical ectodermal ridge growth signal for chick limb development, Science. 1 avr, vol.264, issue.5155, pp.104-111, 1994. ,
Role of fibroblast growth factor 2 and wnt signaling in anabolic effects of parathyroid hormone on bone formation, J Cell Physiol, vol.227, issue.11, pp.3539-3584, 2012. ,
Disruption of the fibroblast growth factor-2 gene results in decreased bone mass and bone formation, J Clin Invest. 15 avr, vol.105, issue.8, pp.1085-93, 2000. ,
Genetic evidence that FGFs have an instructive role in limb proximal-distal patterning, Nature. mai, vol.453, issue.7193, pp.401-406, 2008. ,
Normal limb development in conditional mutants of Fgf4, Development. 1 mars, vol.127, issue.5, pp.989-96, 2000. ,
Fgf8 is required for outgrowth and patterning of the limbs, Nat Genet. déc, vol.26, issue.4, pp.455-464, 2000. ,
FGF9 regulates early hypertrophic chondrocyte differentiation and skeletal vascularization in the developing stylopod, Dev Biol. 15 juill, vol.307, issue.2, pp.300-313, 2007. ,
The roles of FGFs in the early development of vertebrate limbs, Genes Dev. 6 janv, vol.12, issue.11, pp.1571-86, 1998. ,
The mesenchymal factor, FGF10, initiates and maintains the outgrowth of the chick limb bud through interaction with FGF8, an apical ectodermal factor, Development. 1 juin, vol.124, issue.11, pp.2235-2279, 1997. ,
Fibroblast growth factor receptor 2 (FGFR2)-mediated reciprocal regulation loop between FGF8 and FGF10 is essential for limb induction, Development. 15 févr, vol.125, issue.4, pp.753-65, 1998. ,
Coordination of chondrogenesis and osteogenesis by fibroblast growth factor 18, Genes Dev. 4 janv, vol.16, issue.7, pp.859-69, 2002. ,
FGF18 is required for normal cell proliferation and differentiation during osteogenesis and chondrogenesis, Genes Dev. 4 janv, vol.16, issue.7, pp.870-879, 2002. ,
FGF23 production by osteocytes, Pediatr Nephrol. 1 avr, vol.28, issue.4, pp.563-571, 2013. ,
Fibroblast Growth Factor 23 and Klotho Are Present in the Growth Plate, Connect Tissue Res. 1 avr, vol.54, issue.2, pp.108-125, 2013. ,
A Ser250Trp substitution in mouse fibroblast growth factor receptor 2 (Fgfr2) results in craniosynostosis, Bone. 1 août, vol.33, issue.2, pp.169-78, 2003. ,
Fibroblast Growth Factor Receptor 3 Is a Negative Regulator of Bone Growth, Cell. 22 mars, vol.84, issue.6, pp.911-932, 1996. ,
FGF9 monomer/dimer equilibrium regulates extracellular matrix affinity and tissue diffusion, Nat Genet. mars, vol.41, issue.3, pp.289-98, 2009. ,
Transgenic Mice Expressing Fibroblast Growth Factor 23 under the Control of the ?1(I) Collagen Promoter Exhibit Growth Retardation, Osteomalacia, and Disturbed Phosphate Homeostasis, Endocrinology. 1 juill, vol.145, issue.7, pp.3087-94, 2004. ,
,
Yi Chuan Xue Za Zhi Zhonghua Yixue Yichuanxue Zazhi Chin, J Med Genet. déc, vol.21, issue.6, pp.537-578, 2004. ,
Nuclear FGF2 Isoforms Inhibit Bone Marrow Stromal Cell Mineralization through FGF23/FGFR/MAPK In Vitro, J Bone Miner Res Off J Am Soc Bone Miner Res. janv, vol.28, issue.1, pp.35-45, 2013. ,
A Pro250Arg substitution in mouse Fgfr1 causes increased expression of Cbfa1 and premature fusion of calvarial sutures, Hum Mol Genet. 12 août, vol.9, issue.13, pp.2001-2009, 2000. ,
Rapid detection of G1138A and G1138C mutations of the FGFR3 gene in patients with achondroplasia using high-resolution melting analysis, Genet Test Mol Biomark. avr, vol.16, issue.4, pp.297-301, 2012. ,
The paradox of FGFR3 signaling in skeletal dysplasia: Why chondrocytes growth arrest while other cells over proliferate, Mutat Res Mutat Res. 1 janv, vol.759, pp.40-48, 2014. ,
Gly369Cys mutation in mouse FGFR3 causes achondroplasia by affecting both chondrogenesis and osteogenesis, J Clin Invest. 1 déc, vol.104, issue.11, pp.1517-1542, 1999. ,
Repression of hedgehog signaling and BMP4 expression in growth plate cartilage by fibroblast growth factor receptor 3. Development. 15 déc, vol.125, pp.4977-88, 1998. ,
Restrained chondrocyte proliferation and maturation with abnormal growth plate vascularization and ossification in human FGFR-3(G380R) transgenic mice, Hum Mol Genet. 22 janv, vol.9, issue.2, pp.249-58, 2000. ,
A mouse model for achondroplasia produced by targeting fibroblast growth factor receptor 3, Proc Natl Acad Sci. 13 avr, vol.96, issue.8, pp.4455-60, 1999. ,
A neonatal lethal mutation in FGFR3 uncouples proliferation and differentiation of growth plate chondrocytes in embryos, Hum Mol Genet. 1 juill, vol.9, issue.11, pp.1603-1616, 2000. ,
A Lys644Glu substitution in fibroblast growth factor receptor 3 (FGFR3) causes dwarfism in mice by activation of STATs and ink4 cell cycle inhibitors, Hum Mol Genet. 1 janv, vol.8, issue.1, pp.35-44, 1999. ,
Constitutive activation of MEK1 in chondrocytes causes Stat1-independent achondroplasia-like dwarfism and rescues the Fgfr3-deficient mouse phenotype, Genes Dev. 1 févr, vol.18, issue.3, pp.290-305, 2004. ,
Formation of cartilage-like spheroids by micromass cultures of murine C3H10T1/2 cells upon treatment with transforming growth factor-?1, Differentiation. 1 juill, vol.59, issue.1, pp.25-34, 1995. ,
Promotion of embryonic chick limb cartilage differentiation by transforming growth factor-?, Dev Biol, vol.135, issue.2, pp.424-454, 1989. ,
Role of transforming growth factor-? in chondrogenic pattern formation in the embryonic limb: Stimulation of mesenchymal condensation and fibronectin gene expression by exogenenous TGF-? and evidence for endogenous TGF-?-like activity, Dev Biol. 1 mai, vol.145, issue.1, pp.99-109, 1991. ,
TGF-?1 Prevents Hypertrophy of Epiphyseal Chondrocytes: Regulation of Gene Expression for Cartilage Matrix Proteins and Metalloproteases, Dev Biol. 1 août, vol.158, issue.2, pp.414-443, 1993. ,
Terminal Differentiation of Chondrocytes in Culture Is a Spontaneous Process and Is Arrested by Transforming Growth Factor-?2 and Basic Fibroblast Growth Factor in Synergy, Exp Cell Res. 1 janv, vol.216, issue.1, pp.191-199, 1995. ,
Opposite effects of osteogenic protein and transforming growth factor ? on chondrogenesis in cultured long bone rudiments, J Bone Miner Res, vol.9, issue.6, pp.771-80, 1994. ,
Terminal differentiation and calcification in rabbit chondrocyte cultures grown in centrifuge tubes: regulation by transforming growth factor beta and serum factors, Proc Natl Acad Sci. 1 déc, vol.85, issue.24, pp.9552-9558, 1988. ,
Autocrine or paracrine transforming growth factor-beta modulates the phenotype of chick embryo sternal chondrocytes in serum-free agarose culture, J Biol Chem. 3 mai, vol.268, issue.7, pp.5156-61, 1993. ,
Transforming Growth Factor-?-mediated Chondrogenesis of Human Mesenchymal Progenitor Cells Involves N-cadherin and Mitogen-activated Protein Kinase and Wnt Signaling Crosstalk, J Biol Chem, vol.278, issue.42, pp.41227-41263, 2003. ,
TGF? and Wnt crosstalk: embryonic to in vitro cartilage development from mesenchymal stem cells, J Tissue Eng Regen Med, vol.9, issue.4, pp.332-374, 2013. ,
Expression of a truncated, kinase-defective TGF-beta type II receptor in mouse skeletal ,
Maintaining and restoring mobility in middle and old age: the importance of the soft tissues, Instr Course Lect, vol.46, pp.459-69, 1997. ,
Articular cartilage: degeneration and osteoarthritis, repair, regeneration, and transplantation, Instr Course Lect, vol.47, pp.487-504, 1998. ,
Articular cartilage: structure, injuries and review of management, Br Med Bull. 1 sept, vol.87, issue.1, pp.77-95, 2008. ,
Changes in the expression of collagen genes show two stages in chondrocyte differentiation in vitro, J Cell Biol. 1 févr, vol.106, issue.2, pp.461-468, 1988. ,
Spatiotemporal pattern of type X collagen gene expression and collagen deposition in embryonic chick vertebrae undergoing endochondral ossification, Anat Rec. 1 avr, vol.229, issue.4, pp.462-72, 1991. ,
A fibrillar collagen gene, Col11a1, is essential for skeletal morphogenesis, Cell. 10 févr, vol.80, issue.3, pp.423-453, 1995. ,
New insights into the function of collagens from genetic analysis, Curr Opin Cell Biol. 1 janv, vol.7, issue.5, pp.720-727, 1995. ,
What Is Their Function, and Are They Involved in Articular Disease?, Arthritis Rheum, vol.32, issue.3, pp.241-247, 1989. ,
Type II achondrogenesis-hypochondrogenesis: identification of abnormal type II collagen, Am J Hum Genet. déc, vol.43, issue.6, pp.904-917, 1988. ,
Widely distributed mutations in the COL2A1 gene produce achondrogenesis type II/hypochondrogenesis, Am J Med Genet, vol.92, issue.2, pp.95-100, 2000. ,
Small deletions in the type II collagen triple helix produce Kniest dysplasia, Am J Med Genet, vol.85, issue.2, pp.105-117, 1999. ,
Rapid determination of COL2A1 mutations in individuals with Stickler syndrome: Analysis of potential premature termination codons, Am J Med Genet, vol.94, issue.2, pp.141-149, 2000. ,
Dominant mutations in the type II collagen gene, COL2A1 , produce spondyloepimetaphyseal dysplasia, Strudwick type, Nat Genet. sept, vol.11, issue.1, p.87, 1995. ,
Collagens-structure, function, and biosynthesis. Adv Drug Deliv Rev, vol.55, pp.1531-1577, 2003. ,
Dysregulation of Chondrogenesis in Human Cleidocranial Dysplasia, Am J Hum Genet. 1 août, vol.77, issue.2, pp.305-317, 2005. ,
Identification and characterization of the novel Col10a1 regulatory mechanism during chondrocyte hypertrophic differentiation, Cell Death Dis. oct, vol.5, issue.10, p.1469, 2014. ,
Type X collagen gene regulation by Runx2 contributes directly to its hypertrophic chondrocyte-specific expression in vivo, J Cell Biol. 1 sept, vol.162, issue.5, pp.833-875, 2003. ,
Suppression of genes related to hypertrophy and osteogenesis in committed human mesenchymal stem cells cultured on novel nitrogen-rich plasma polymer coatings, Tissue Eng. sept, vol.12, issue.9, pp.2639-2686, 2006. ,
Novel insights into the mechanism of decreased expression of type X collagen in human mesenchymal stem cells from patients with osteoarthritis cultured on nitrogen-rich plasma polymers: Implication of cyclooxygenase-1, J Biomed Mater Res A, vol.94, issue.3, pp.744-50, 2010. ,
, Transmembrane Signaling Proteoglycans. Annu Rev Cell Dev Biol, vol.26, issue.1, pp.89-114, 2010.
Proteoglycan form and function: A comprehensive nomenclature of proteoglycans, Matrix Biol. mars, vol.42, pp.11-55, 2015. ,
Synthesis and sorting of proteoglycans, J Cell Sci. 15 janv, vol.113, issue.2, pp.193-205, 2000. ,
The Content and Size of Hyaluronan in Biological Fluids and Tissues, Front Immunol, vol.6, 2015. ,
Betaglycan: A multifunctional accessory, Mol Cell Endocrinol. 6 juin, vol.339, issue.1, pp.180-189, 2011. ,
Interaction of the small interstitial proteoglycans biglycan, decorin and fibromodulin with transforming growth factor ?, Biochem J. 1 sept, vol.302, issue.2, pp.527-561, 1994. ,
Functions of heparan sulfate proteoglycans in cell signaling during development, Development. 15 déc, vol.131, issue.24, pp.6009-6030, 2004. ,
FGFs, heparan sulfate and FGFRs: complex interactions essential for development, BioEssays. 31 janv, vol.22, issue.2, pp.108-120, 2000. ,
The Structure of Glycosaminoglycans and their Interactions with Proteins, Chem Biol Drug Des. 1 déc, vol.72, issue.6, pp.455-82, 2008. ,
Serglycin: A Structural and Functional Chameleon with Wide Impact on Immune Cells, J Immunol, vol.15, issue.10, pp.4927-4960, 2011. ,
The aggrecanopathies; an evolving phenotypic spectrum of human genetic skeletal diseases, Orphanet J Rare Dis. 28 juin, vol.11, issue.1, p.86, 2016. ,
, Cartilage proteoglycans. Semin Cell Dev Biol. 1 avr, vol.12, issue.2, pp.69-78, 2001.
Analysis of aggrecan and tenascin gene expression in mouse skeletal tissues by Northern and in situ hybridization using species specific cDNA probes, Biochim Biophys Acta BBA -Gene Struct Expr, vol.22, issue.3, pp.613-635, 1994. ,
A Recessive Skeletal Dysplasia, SEMD Aggrecan Type, Results from a Missense Mutation Affecting the C-Type Lectin Domain of Aggrecan, Am J Hum Genet. 9 janv, vol.84, issue.1, pp.72-81, 2009. ,
Mouse cartilage matrix deficiency ( cmd ) caused by a 7 bp deletion in the aggrecan gene, Nat Genet. juin, vol.7, issue.2, p.154, 1994. ,
Dwarfism and ageassociated spinal degeneration of heterozygote cmd mice defective in aggrecan, Proc Natl Acad Sci. 24 juin, vol.94, issue.13, pp.6943-6950, 1997. ,
Alternative Splicing in the Aggrecan G3 Domain Influences Binding Interactions with Tenascin-C and Other Extracellular Matrix Proteins, J Biol Chem. 26 mars, vol.279, issue.13, pp.12511-12519, 2004. ,
Developmental regulation of the growth plate, Nature. mai, vol.423, issue.6937, pp.332-338, 2003. ,
Indian Hedgehog produced by postnatal chondrocytes is essential for maintaining a growth plate and trabecular bone, Proc Natl Acad Sci. 10 avr, vol.104, issue.15, pp.6382-6389, 2007. ,
Aggrecan modulation of growth plate morphogenesis, Dev Biol. 15 mai, vol.329, issue.2, pp.242-57, 2009. ,
Shaping Morphogen Gradients by Proteoglycans, Cold Spring Harb Perspect Biol. 9 janv, vol.1, issue.3, p.2493, 2009. ,
Versican overexpression in human breast cancer lesions: Known and new isoforms for stromal tumor targeting, Int J Cancer, vol.126, issue.3, pp.640-50, 2010. ,
Versican and the control of inflammation, Matrix Biol. 1 avr, vol.35, pp.152-61, 2014. ,
A large chondroitin sulfate proteoglycan (PG-M) synthesized before chondrogenesis in the limb bud of chick embryo, J Biol Chem, vol.261, issue.29, pp.13517-13542, 1986. ,
cDNA cloning of PG-M, a large chondroitin sulfate proteoglycan expressed during chondrogenesis in chick limb buds. Alternative spliced multiforms of PG-M and their relationships to versican, J Biol Chem. 7 mai, vol.268, pp.14461-14470, 1993. ,
Developmental expression of S103L cross-reacting proteoglycans in embryonic chick, Prog Clin Biol Res, vol.383, pp.505-519, 1993. ,
Proteoglycans in health and disease: novel roles for proteoglycans in malignancy and their pharmacological targeting, FEBS J, vol.277, pp.3904-3927, 2010. ,
Syndecans as cell surface receptors: Unique structure equates with functional diversity, Matrix Biol. 1 mars, vol.30, issue.2, pp.93-102, 2011. ,
Syndecans in cartilage breakdown and synovial inflammation, Nat Rev Rheumatol. janv, vol.9, issue.1, pp.43-55, 2013. ,
Proteoglycans in health and disease: the multiple roles of syndecan shedding, FEBS J, vol.277, pp.3876-89, 2010. ,
Fine-tuning of cell signaling by glypicans, Cell Mol Life Sci CMLS. mars, vol.68, issue.6, pp.923-932, 2011. ,
URL : https://hal.archives-ouvertes.fr/inserm-00202709
, Genome Biol. 22 mai, vol.9, issue.5, p.224, 2008.
The type III TGF-? receptor regulates epithelial and cancer cell migration through ?-arrestin2-mediated activation of Cdc42, Proc Natl Acad Sci, vol.106, issue.3, pp.8221-8227, 2009. ,
The structure and function of cartilage proteoglycans. Eur Cell Mater, vol.12, pp.92-101, 2006. ,
Proteodermatan and Proteokeratan Sulfate (Decorin, Lumican/Fibromodulin) Proteins Are Horseshoe Shaped. Implications for Their Interactions with Collagen, Biochemistry. 1 janv, vol.35, issue.27, pp.8795-8804, 1996. ,
Enzymatic Degradation of Chondromucoprotein, J Biol Chem. 10 janv, vol.239, issue.10, pp.3312-3332, 1964. ,
Glycosylation of serine residues by a uridine diphosphate-xylose: Protein xylosyltransferase from mouse mastocytoma, Arch Biochem Biophys. 1 janv, vol.116, pp.391-399, 1966. ,
Incorporation of D-xylose-C14 into glycoprotein by particles from hen oviduct, Biochem Biophys Res Commun. 22 mars, vol.22, issue.6, pp.672-679, 1966. ,
Biosynthesis of Chondroitin Sulfate Proteoglycan xylosyl transfer to smith-dgraded cartilage proteoglycan and other exogenous acceptors, J Biol Chem. 25 juin, vol.247, issue.12, pp.3838-3885, 1972. ,
Deglycosylation of chondroitin sulfate proteoglycan and derived peptides, Biochemistry. 30 janv, vol.29, issue.4, pp.907-921, 1990. ,
Recognition of Acceptor Proteins by UDP-Dxylose Proteoglycan Core Protein ?-D-Xylosyltransferase, J Biol Chem. 25 avr, vol.272, issue.17, pp.11171-11176, 1997. ,
Silk-A new substrate for UDP-d-xylose: Proteoglycan core protein ?-d-xylosyltransferase, Anal Biochem. 1 mars, vol.137, issue.2, pp.505-521, 1984. ,
Analysis of glycosaminoglycan substitution in decorin by site-directed mutagenesis, J Biol Chem. 25 mars, vol.265, issue.9, pp.5317-5340, 1990. ,
The never-ending story of peptide O-xylosyltransferase, Cell Mol Life Sci CMLS. avr, vol.61, issue.7-8, pp.794-809, 2004. ,
Isolation and sequence analysis of the glycosaminoglycan attachment site of type IX collagen, J Biol Chem. 15 janv, vol.263, issue.2, pp.752-758, 1988. ,
Molecular Cloning and Expression of Human UDP-d-Xylose:Proteoglycan Core Protein ?-dXylosyltransferase and its First Isoform XT-II, J Mol Biol. déc, vol.304, issue.4, pp.517-545, 2000. ,
Biosynthesis of Chondroitin and Heparan Sulfate in Chinese Hamster Ovary Cells Depends on Xylosyltransferase II, J Biol Chem. 23 févr, vol.282, issue.8, pp.5195-200, 2007. ,
Human xylosyltransferase II is involved in the biosynthesis of the uniform tetrasaccharide linkage region in chondroitin sulfate and heparan sulfate proteoglycans, J Biol Chem. 23 févr, vol.282, issue.8, pp.5201-5207, 2007. ,
XT-II, the second isoform of human peptide-Oxylosyltransferase, displays enzymatic activity, J Biol Chem. 2 mars, vol.282, issue.9, pp.5984-90, 2007. ,
Differences in gene expression of human xylosyltransferases and determination of acceptor specificities for various proteoglycans, Biochem Biophys Res Commun. 1 janv, vol.391, issue.1, pp.685-91, 2010. ,
Sequence-Function Relationships of Prokaryotic and Eukaryotic Galactosyltransferases, J Biochem (Tokyo), vol.123, issue.6, pp.1000-1009, 1998. ,
URL : https://hal.archives-ouvertes.fr/hal-00314475
Activity of the yeast MNN1 ?-1,3-mannosyltransferase requires a motif conserved in many other families of glycosyltransferases, Proc Natl Acad Sci. 7 juill, vol.95, issue.14, pp.7945-50, 1998. ,
Analysis of the DXD motifs in human xylosyltransferase I required for enzyme activity, J Biol Chem, vol.279, issue.41, pp.42566-73, 2004. ,
Human xylosyltransferase I and N-terminal truncated forms: functional characterization of the core enzyme, Biochem J. 15 févr, vol.394, pp.163-71, 2006. ,
Human alpha 1,3/4 fucosyltransferases. Characterization of highly conserved cysteine residues and Nlinked glycosylation sites, J Biol Chem. 11 août, vol.275, issue.32, pp.24237-24282, 2000. ,
URL : https://hal.archives-ouvertes.fr/hal-01211856
Identification of Functional Cysteine Residues in Human Galactosyltransferase, Biochem Biophys Res Commun, vol.204, issue.2, pp.701-710, 1994. ,
Human xylosyltransferase I: functional and biochemical characterization of cysteine residues required for enzymic activity, Biochem J. 1 mars, vol.386, pp.227-263, 2005. ,
Structural Basis for the Initiation of Glycosaminoglycan Biosynthesis by Human Xylosyltransferase 1. Struct Lond Engl 1993. 5 juin, vol.26, pp.801-809, 2018. ,
N-linked protein glycosylation in the ER, Biochim Biophys Acta BBA -Mol Cell Res, vol.1833, issue.11, pp.2430-2437, 2013. ,
Xylosylation and glucuronosylation reactions in rat liver Golgi apparatus and endoplasmic reticulum, J Biol Chem. 10 mai, vol.261, issue.28, pp.12936-12977, 1986. ,
Xylosyl transfer to the core protein precursor of the rat chondrosarcoma proteoglycan, J Biol Chem. 11 mai, vol.264, issue.31, pp.18775-80, 1989. ,
Subcelluar Sites for Synthesis of Chondromucoprotein of Cartilage, J Cell Biol. 1 août, vol.38, issue.2, pp.358-68, 1968. ,
Location of xylosyltransferase in the cisternae of the rough endoplasmic reticulum of embryonic cartilage cells, Connect Tissue Res, vol.12, issue.2, pp.151-63, 1984. ,
Xylosylation is an endoplasmic reticulum to Golgi event, J Biol Chem. 25 mai, vol.268, issue.15, pp.11105-11117, 1993. ,
Topography of glycosylation and UDP-xylose production, J Biol Chem. 25 mai, vol.268, issue.15, pp.11097-104, 1993. ,
Cloning and recombinant expression of active full-length xylosyltransferase I (XT-I) and characterization of subcellular localization of XT-I and XT-II, J Biol Chem. 19 mai, vol.281, issue.20, pp.14224-14255, 2006. ,
Polycystic disease caused by deficiency in xylosyltransferase 2, an initiating enzyme of glycosaminoglycan biosynthesis, Proc Natl Acad Sci. 29 mai, vol.104, issue.22, pp.9416-9437, 2007. ,
Human xylosyltransferases in health and disease, Cell Mol Life Sci. juin, vol.64, issue.12, pp.1498-517, 2007. ,
,
, Xylosyltransferase II is a significant contributor of circulating xylosyltransferase levels and platelets constitute an important source of xylosyltransferase in serum, Glycobiology. août, vol.19, issue.8, pp.829-862, 2009.
Xylosyltransferase II is the predominant isoenzyme which is responsible for the steady-state level of xylosyltransferase activity in human serum, Biochem Biophys Res Commun. 10 avr, vol.459, issue.3, pp.469-74, 2015. ,
Homozygosity for Frameshift Mutations in XYLT2 Result in a Spondylo-Ocular Syndrome with Bone Fragility, Cataracts, and Hearing Defects, Am J Hum Genet. 4 juin, vol.96, issue.6, pp.971-979, 2015. ,
The missing "link": an autosomal recessive short stature syndrome caused by a hypofunctional XYLT1 mutation, Hum Genet, vol.133, issue.1, pp.29-39, 2013. ,
XYLT1 Mutations in Desbuquois Dysplasia Type 2, Am J Hum Genet. 6 mars, vol.94, issue.3, pp.405-419, 2014. ,
URL : https://hal.archives-ouvertes.fr/hal-01704452
Complete and partial XYLT1 deletion in a patient with neonatal short limb skeletal dysplasia, Am J Med Genet A, vol.170, issue.2, pp.510-514, 2015. ,
Novel and recurrent XYLT1 mutations in two Turkish families with Desbuquois dysplasia, type 2, J Hum Genet, vol.62, issue.3, pp.447-51, 2016. ,
Exome sequencing reveals two novel compound heterozygous XYLT1 mutations in a Polish patient with Desbuquois dysplasia type 2 and growth hormone deficiency, J Hum Genet. juill, vol.61, issue.7, pp.577-83, 2016. ,
Desbuquois dysplasia type II in a patient with a homozygous mutation in XYLT1 and new unusual findings, Am J Med Genet A, vol.170, issue.11, pp.3043-3050, 2016. ,
Endoplasmic reticulum retention of xylosyltransferase 1 (XYLT1) mutants underlying Desbuquois dysplasia type II, Am J Med Genet A, 2017. ,
Forward genetics defines Xylt1 as a key, conserved regulator of early chondrocyte maturation and skeletal length, Dev Biol. 1 janv, vol.385, issue.1, pp.67-82, 2014. ,
Primary culture and phenotyping of murine chondrocytes, Nat Protoc. août, vol.3, issue.8, pp.1253-60, 2008. ,
Preparation of mouse embryonic fibroblast cells suitable for culturing human embryonic and induced pluripotent stem cells, J Vis Exp JoVE. 21 juin, issue.64, 2012. ,
Interpreting Neonatal Lethal Phenotypes in Mouse Mutants: Insights Into Gene Function and Human Diseases, Physiol Rev. janv, vol.89, issue.1, pp.1-26, 2009. ,
Multifaceted signaling regulators of chondrogenesis: Implications in cartilage regeneration and tissue engineering, Genes Dis. déc, vol.2, issue.4, pp.307-334, 2015. ,
, Ihh and Runx2/Runx3 Signaling Interact to Coordinate Early Chondrogenesis: A Mouse Model, vol.8, p.55296, 2013.
Enzymes active in the areas undergoing cartilage resorption during the development of the secondary ossification center in the tibiae of rats aged 0-21 days. II. Two proteinases, gelatinase B and collagenase-3, are implicated in the lysis of collagen fibrils, Dev Dyn. sept, vol.222, issue.1, pp.71-88, 2001. ,
TGF-? signaling is essential for joint morphogenesis, J Cell Biol. 18 juin, vol.177, issue.6, pp.1105-1122, 2007. ,
Early Embryonic Lethality in Genetically Engineered Mice: Diagnosis and Phenotypic Analysis, Vet Pathol. 1 janv, vol.49, issue.1, pp.64-70, 2012. ,
Pathology Methods for the Evaluation of Embryonic and Perinatal Developmental Defects and Lethality in Genetically Engineered Mice, Vet Pathol. 1 janv, vol.49, issue.1, pp.71-84, 2012. ,
The control of chondrogenesis, J Cell Biochem. 1 janv, vol.97, issue.1, pp.33-44, 2006. ,
Control of chondrogenesis by the transcription factor Sox9, Mod Rheumatol. juin, vol.18, issue.3, pp.213-222, 2008. ,
PTHrP and Ihh in chondrocytes, vol.10, 2002. ,
Indian hedgehog signaling regulates proliferation and differentiation of chondrocytes and is essential for bone formation, Genes Dev. 15 août, vol.13, issue.16, pp.2072-86, 1999. ,
Interactions between Sox9 and -catenin control chondrocyte differentiation, Genes Dev. 22 avr, vol.18, issue.9, pp.1072-87, 2004. ,
Sulfation of chondroitin sulfate proteoglycans is necessary for proper Indian hedgehog signaling in the developing growth plate, Development. 15 mai, vol.136, issue.10, pp.1697-706, 2009. ,
Ext1-Dependent Heparan Sulfate Regulates the Range of Ihh Signaling during Endochondral Ossification, Dev Cell. juin, vol.6, issue.6, pp.801-814, 2004. ,
Receptor Specificity of the Fibroblast Growth Factor Family, vol.7, 1996. ,
Cell surface, heparin-like molecules are required for binding of basic fibroblast growth factor to its high affinity receptor, Cell. févr, vol.64, issue.4, pp.841-849, 1991. ,
Receptor Specificity of the Fibroblast Growth Factor Family: THE COMPLETE MAMMALIAN FGF FAMILY, J Biol Chem. 9 juin, vol.281, issue.23, pp.15694-700, 2006. ,
PI3K/Akt signaling as a key regulatory pathway for chondrocyte terminal differentiation, Genes Cells. août, vol.13, issue.8, pp.839-50, 2008. ,
Advances in fibroblast growth factor signaling in growth plate development and disorders, J Mol Endocrinol. août, vol.53, issue.1, pp.11-34, 2014. ,
Mutations in the gene encoding fibroblast growth factor receptor-3 in achondroplasia, Nature. 15 sept, vol.371, issue.6494, pp.252-256, 1994. ,
Up-regulation of the chondrogenic Sox9 gene by fibroblast growth factors is mediated by the mitogenactivated protein kinase pathway, Proc Natl Acad Sci. 1 févr, vol.97, issue.3, pp.1113-1121, 2000. ,
A-Raf and B-Raf Are Dispensable for Normal Endochondral Bone Development, and Parathyroid Hormone-Related Peptide Suppresses Extracellular Signal-Regulated Kinase Activation in Hypertrophic Chondrocytes, Mol Cell Biol. 1 janv, vol.28, issue.1, pp.344-57, 2008. ,
Raf signaling stimulates and represses the human collagen X promoter through distinguishable elements, J Cell Biochem. 15 mars, vol.72, issue.4, pp.549-57, 1999. ,
Expression cloning and characterization of the TGF-? type III receptor, Cell, vol.15, issue.4, pp.797-805, 1991. ,
Tendon-bone attachment unit is formed modularly by a distinct pool of Scx-and Sox9-positive progenitors, Development. 1 juill, vol.140, issue.13, pp.2680-90, 2013. ,
Premature arthritis is a distinct type II collagen phenotype, Arthritis Rheum. mai, vol.62, issue.5, pp.1421-1451, 2010. ,
Mutation in the type II collagen gene (COL2AI) as a cause of primary osteoarthritis associated with mild spondyloepiphyseal involvement, Semin Arthritis Rheum. août, vol.44, issue.1, pp.101-105, 2014. ,
Growth plate regulation and osteochondroma formation: insights from tracing proteoglycans in zebrafish models and human cartilage, J. Pathol, vol.224, pp.160-168, 2011. ,
Proteoglycan Signaling Co-receptors: Roles in Cell Adhesion, Migration and Invasion, Cell. Signal, vol.21, pp.1548-1558, 2009. ,
Shaping morphogen gradients by proteoglycans, Cold Spring Harb. Perspect. Biol, vol.1, p.2493, 2009. ,
Sulfation of chondroitin sulfate proteoglycans is necessary for proper Indian hedgehog signaling in the developing growth plate, Dev. Camb. Engl, vol.136, pp.1697-1706, 2009. ,
Proteoglycan form and function: A comprehensive nomenclature of proteoglycans, Matrix Biol, vol.42, pp.11-55, 2015. ,
Synthesis and sorting of proteoglycans, J. Cell Sci, vol.113, pp.193-205 ,
Initiation of chondroitin sulfate biosynthesis: a kinetic analysis of UDP-D-xylose: core protein beta-D-xylosyltransferase, Biochemistry (Mosc.), vol.30, pp.7477-7483, 1991. ,
Cloning and recombinant expression of active full-length xylosyltransferase I (XT-I) and characterization of subcellular localization of XT-I and XT-II, J. Biol. Chem, vol.281, pp.14224-14231, 2006. ,
Human xylosyltransferase I: functional and biochemical characterization of cysteine residues required for enzymic activity, Biochem. J, vol.386, pp.227-236, 2005. ,
Xylosyltransferase-I Regulates Glycosaminoglycan Synthesis during the Pathogenic Process of Human Osteoarthritis, PloS One, vol.7, pp.1-9, 2012. ,
Regulation of xylosyltransferase I gene expression by interleukin 1? in human primary chondrocyte cells: mechanism and impact on proteoglycan synthesis, J. Biol. Chem, vol.288, pp.1774-1784, 2013. ,
URL : https://hal.archives-ouvertes.fr/hal-01464669
Defective initiation of glycosaminoglycan synthesis due to B3GALT6 mutations causes a pleiotropic Ehlers-Danlos-syndrome-like connective tissue disorder, Am. J. Hum. Genet, vol.92, pp.935-945, 2013. ,
URL : https://hal.archives-ouvertes.fr/hal-01451641
Expanding the clinical spectrum of B4GALT7 deficiency: homozygous p.R270C mutation with founder effect causes Larsen of Reunion Island syndrome, Eur. J. Hum. Genet. EJHG, vol.23, pp.49-53, 2015. ,
Mutations in B3GALT6, which encodes a glycosaminoglycan linker region enzyme, cause a spectrum of skeletal and connective tissue disorders, Am. J. Hum. Genet, vol.92, pp.927-934, 2013. ,
Skeletal dysplasia in a consanguineous clan from the island of Nias/Indonesia is caused by a novel mutation in B3GAT3, Hum. Genet, vol.134, pp.691-704, 2015. ,
BMP signalling in skeletal development, disease and repair, Nat. Rev. Endocrinol, vol.12, pp.203-221, 2016. ,
Mechanism of longitudinal bone growth and its regulation by growth plate chondrocytes, Microsc. Res. Tech, vol.28, pp.505-519, 1994. ,
Proteoglycans of the extracellular matrix and growth control, J. Cell. Physiol, vol.189, pp.266-274, 2001. ,
Beta1 integrins regulate chondrocyte rotation, G1 progression, and cytokinesis, Genes Dev, vol.17, pp.2465-2479, 2003. ,
Developmental Regulation of Wnt/Beta-Catenin Signals Is Required for Growth Plate Assembly, Cartilage Integrity, and Endochondral Ossification, The Journal of Biological Chemistry, vol.280, pp.19185-19195, 2005. ,
Structural and mechanical properties of the proliferative zone of the developing murine growth plate cartilage assessed by atomic force microscopy, Matrix Biol, vol.50, pp.1-15, 2016. ,
Growth factor binding to the pericellular matrix and its importance in tissue engineering, Adv. Drug Deliv. Rev, vol.59, pp.1366-1381, 2007. ,
Genetic diseases of connective tissues: cellular and extracellular effects of ECM mutations, Nat. Rev. Genet, vol.10, pp.173-183, 2009. ,
Endoplasmic reticulum retention of xylosyltransferase 1 (XYLT1) mutants underlying Desbuquois dysplasia type II, Am. J. Med. Genet. A, vol.999, pp.1-9, 2017. ,
Desbuquois dysplasia type II in a patient with a homozygous mutation in XYLT1 and new unusual findings, Am. J. Med. Genet. A, vol.170, pp.3043-3047, 2016. ,
Exome sequencing reveals two novel compound heterozygous XYLT1 mutations in a Polish patient with Desbuquois dysplasia type 2 and growth hormone deficiency, J. Hum. Genet, vol.61, pp.577-583, 2016. ,
XYLT1 Mutations in Desbuquois Dysplasia Type 2, Am. J. Hum. Genet, vol.94, pp.405-414, 2014. ,
URL : https://hal.archives-ouvertes.fr/hal-01704452
The missing 'link': an autosomal recessive short stature syndrome caused by a hypofunctional XYLT1 mutation, Hum. Genet, vol.133, pp.29-39, 2013. ,
Desbuquois dysplasia, a reevaluation with abnormal and 'normal' hands: radiographic manifestations, Am. J. Med. Genet. A, vol.124, pp.48-53, 2004. ,
Conditional Expression of Wnt4 during Chondrogenesis Leads to Dwarfism in Mice, PLoS ONE, vol.2, p.450, 2007. ,
The Hedgehog signalling pathway in bone formation, Int. J. Oral Sci, vol.7, pp.73-79, 2015. ,
Dual roles of Wnt signaling during chondrogenesis in the chicken limb, Dev. Camb. Engl, vol.127, pp.3141-3159, 2012. ,
Role of glycosaminoglycans in cellular communication, Acc. Chem. Res, vol.37, pp.431-438, 2004. ,
EXT1 regulates chondrocyte proliferation and differentiation during endochondral bone development, Bone, vol.36, pp.379-386, 2005. ,
Aggrecan modulation of growth plate morphogenesis, Dev. Biol, vol.329, pp.242-257, 2008. ,
Chondroitin sulfate N-acetylgalactosaminyltransferase-1 is required for normal cartilage development, Biochem. J, vol.432, pp.47-55, 2010. ,
Chondroitin sulfate synthase 1 (Chsy1) is required for bone development and digit patterning, Dev. Biol, vol.363, pp.413-425, 2012. ,
Novel and recurrent XYLT1 mutations in two Turkish families with Desbuquois dysplasia, type 2, J. Hum. Genet, vol.62, pp.447-451, 2017. ,
Homozygosity mapping of a Desbuquois dysplasia locus to chromosome 17q25.3, J. Med. Genet, vol.40, pp.282-284, 2003. ,
Reaching a genetic and molecular understanding of skeletal development, Dev. Cell, vol.2, pp.389-406, 2002. ,
Morphogenesis and dysmorphogenesis of the appendicular skeleton, Birth Defects Res. Part C Embryo Today Rev, vol.69, pp.102-122, 2003. ,
Depletion of cartilage collagen fibrils in mice carrying a dominant negative Col2a1 transgene affects chondrocyte differentiation, Am. J. Physiol. Cell Physiol, vol.285, pp.1504-1512, 2003. ,
Collagen fibrillogenesis in tendon development: current models and regulation of fibril assembly, Birth Defects Res. Part C Embryo Today Rev, vol.84, pp.228-244, 2008. ,
Decorin regulates assembly of collagen fibrils and acquisition of biomechanical properties during tendon development, J. Cell. Biochem, vol.98, pp.1436-1449, 2006. ,
Effects of decorin proteoglycan on fibrillogenesis, ultrastructure, and mechanics of type I collagen gels, Matrix Biol. J. Int. Soc. Matrix Biol, vol.32, pp.414-423, 2013. ,
Mutations in fam20b and xylt1 reveal that cartilage matrix controls timing of endochondral ossification by inhibiting chondrocyte maturation, PLoS Genet, vol.7, p.1002246, 2011. ,
Forward genetics defines Xylt1 as a key, conserved regulator of early chondrocyte maturation and skeletal length, Dev. Biol, vol.385, pp.67-82, 2014. ,
Noncanonical Wnt induces chondrocyte de-differentiation through Frizzled 6 and DVL-2/Braf/CaMKII?/syndecan 4 axis, Cell Death Differ, vol.25, p.1442, 2018. ,
Quantitative Morphometry for Osteochondral Tissues Using Second Harmonic Generation Microscopy and Image Texture Information, Sci. Rep, vol.8, p.2826, 2018. ,
The importance of the SIBLING family of proteins on skeletal mineralisation and bone remodelling, J. Endocrinol, vol.214, pp.241-255, 2012. ,
, This model was generated by deletion 10.5 kb (promoter and exon1) in Xylt1 gene by homologous recombination. To obtain XT-I KO mice we have crossed XT-I heterozygote females and XT-I heterozygote males and
, For genotyping of littermates, genomic DNA was extracted from the tail shippets using two solution of extraction buffer (solution 1: 25mM NaOH, 0,2mM NA2EDTA ph12, solution 2: 40mM Tris-HCL ph5). Genotyping was performed according to
Ef/Wr for the 5' part of target locus of the wild type allele (Ef: 5'ctcattccatggtgaacacggg 3', Wr: 3'gctcttcattcattcacatgtcctcatcacc 5'), Ef2/Lxr for Loxp specific sequences (Ef2:5'acagaatttgcagcatatcaacatgatc 3', Lxr: 3'gaagttatactgagcggccgttcac 5'). The results were interpreted according of the size of the PCR product. XT-I KO (364 pb), XT-I WT (404 pb) and XT-I heterozygote ,
, Embryos were dissected and fixed overnight in 96% ethanol. Cartilage elements of skeletons were stained in 0.03% Alcian Blue dye (0.03g Alcian Blue (8GX, Sigma) dissolved in 80 ml 95% ethanol and 20 ml glacial acetic acid). Skeletons were washed twice with 95% ethanol and then
, Bones/mineralized tissues were stained in 2% Alizarin Red (100 ml 1% KOH, 0,02% Alizarin Red (Sigma)) for 4h and cleared in 0,8% KOH in 20% glycerol solution for 24h
, KOH glycerol solution for 48h. Finally, embryonic skeletons were stored in a 50% glycerol, 50% ethanol solution
, Their limbs were dissected independently of each other and were fixed at room temperature for 24h in 10% formalin. Then, they were dehydrated with a series of ethanol baths (70%, 90%, 100%) and then passed through a toluene bath before they were embedded in paraffin. Sections of 5?m sections were cut using the Leica microtome and stained with Blue Alcian (Sigma), Histological analysis and staining XT-I KO embryos and their wild littermates were collected at different embryonic stages at E14.5, E16.5 and E18.5
Proteoglycans of cartilage, p.15 ,
Proteoglycans: Structures and Interactions, p.33 ,
Transmembrane Signaling Proteoglycans, Annu. Rev. Cell Dev. Biol, vol.26, pp.89-114, 2010. ,
Proteoglycan form and function: A comprehensive nomenclature of proteoglycans, Matrix Biol, vol.42, pp.11-55, 2015. ,
Synthesis and sorting of proteoglycans ,
The chondrocyte pericellular matrix: a model for hyaluronan-mediated cell-matrix interactions, Biochem. Soc. Trans, vol.27, pp.142-147, 1999. ,
The cartilage extracellular matrix as a transient developmental scaffold for growth plate maturation, Matrix Biol, pp.363-383, 2016. ,
Molecular Adhesion between Cartilage Extracellular Matrix Macromolecules, Biomacromolecules, vol.15, pp.772-780, 2014. ,
Roles of heparansulphate glycosaminoglycans in cancer, Nat. Rev. Cancer, vol.2, pp.521-528, 2002. ,
Proteoglycans in atherosclerosis and restenosis: key roles for versican, Circ. Res, vol.94, pp.1158-1167, 2004. ,
Heparan sulphate proteoglycans in Alzheimer's disease and amyloid-related disorders, Lancet Neurol, vol.2, pp.482-492, 2003. ,
Chondrocyte-derived apoptotic bodies and calcification of articular cartilage, Proc. Natl. Acad. Sci, vol.95, pp.3094-3099, 1998. ,
Chondrodysplasias due to proteoglycan defects, Glycobiology, vol.12, pp.57-68, 2002. ,
The membranous skeleton: the role of cell condensations in vertebrate skeletogenesis, Anat. Embryol. (Berl.), vol.186, 1992. ,
, , p.32, 2000.
Development of the Endochondral Skeleton, Cold Spring Harb. Perspect. Biol, vol.5, pp.8334-008334, 2013. ,
Developmental regulation of the growth plate, Nature, vol.423, pp.332-336, 2003. ,
The control of chondrogenesis, J. Cell. Biochem, vol.97, pp.33-44, 2006. ,
A pathway to bone: signaling molecules and transcription factors involved in chondrocyte development and maturation, Development, vol.142, pp.817-831, 2015. ,
Mutations in fam20b and xylt1 Reveal That Cartilage Matrix Controls Timing of Endochondral Ossification by Inhibiting Chondrocyte Maturation, PLoS Genet, vol.7, p.1002246, 2011. ,
The missing 'link': an autosomal recessive short stature syndrome caused by a hypofunctional XYLT1 mutation, Hum. Genet, vol.133, pp.29-39, 2014. ,
XYLT1 mutations in Desbuquois dysplasia type 2, Am. J. Hum. Genet, vol.94, pp.405-414, 2014. ,
URL : https://hal.archives-ouvertes.fr/hal-01704452
Complete and partial XYLT1 deletion in a patient with neonatal short limb skeletal dysplasia, Am. J. Med. Genet. A, vol.170, pp.510-514, 2016. ,
Exome sequencing reveals two novel compound heterozygous XYLT1 mutations in a Polish patient with Desbuquois dysplasia type 2 and growth hormone deficiency, J. Hum. Genet, vol.61, pp.577-583, 2015. ,
Desbuquois dysplasia type II in a patient with a homozygous mutation in XYLT1 and new unusual findings, Am. J. Med. Genet. A, vol.170, pp.3043-3047, 2016. ,
Novel and recurrent XYLT1 mutations in two Turkish families with Desbuquois dysplasia, type 2, J. Hum. Genet, vol.62, pp.447-451, 2017. ,
Endoplasmic reticulum retention of xylosyltransferase 1 (XYLT1) mutants underlying Desbuquois dysplasia type II, Am. J. Med. Genet. A, 2017. ,
Interpreting Neonatal Lethal Phenotypes in Mouse Mutants: Insights Into Gene Function and Human Diseases, Physiol. Rev, vol.89, pp.1-26, 2009. ,
Early Embryonic Lethality in Genetically Engineered Mice: Diagnosis and Phenotypic Analysis, Vet. Pathol, vol.49, pp.64-70, 2012. ,
Pathology Methods for the Evaluation of Embryonic and Perinatal Developmental Defects and Lethality in Genetically Engineered Mice, Vet. Pathol, vol.49, pp.71-84, 2012. ,
Forward genetics defines Xylt1 as a key, conserved regulator of early chondrocyte maturation and skeletal length, Dev. Biol, vol.385, pp.67-82, 2014. ,
Molecular Cloning and Expression of Human UDP-d-Xylose: Proteoglycan Core Protein ?-dXylosyltransferase and its First Isoform XT-II, J. Mol. Biol, vol.304, pp.517-528, 2000. ,
Polycystic disease caused by deficiency in xylosyltransferase 2, an initiating enzyme of glycosaminoglycan biosynthesis, Proc. Natl. Acad. Sci, vol.104, pp.9416-9421, 2007. ,
Regulatory mechanisms in the pathways of cartilage and bone formation, Curr. Opin. Cell Biol, vol.13, pp.721-728, 2001. ,
The transcription factor Sox9 has essential roles in successive steps of the chondrocyte differentiation pathway and is required for expression of Sox5 and Sox6, Genes Dev, vol.16, pp.2813-2828, 2002. ,
Sox9 Directs Hypertrophic Maturation and Blocks Osteoblast Differentiation of Growth Plate Chondrocytes, Dev. Cell, vol.22, pp.597-609, 2012. ,
Multifaceted signaling regulators of chondrogenesis: Implications in cartilage regeneration and tissue engineering, Genes Dis, vol.2, pp.307-327, 2015. ,
Regulation of Rate of Cartilage Differentiation by Indian Hedgehog and PTH-Related Protein, Science, vol.273, pp.613-622, 1996. ,
Direct requirement for Ihh signaling in chondrocyte proliferation, vol.10, 2001. ,
Ihh and Runx2/Runx3 Signaling Interact to Coordinate Early Chondrogenesis: A Mouse Model, PLoS ONE, vol.8, p.55296, 2013. ,
Enzymes active in the areas undergoing cartilage resorption during the development of the secondary ossification center in the tibiae of rats aged 0-21 days. II. Two proteinases, gelatinase B and collagenase-3, are implicated in the lysis of collagen fibrils, Dev. Dyn, vol.222, pp.71-88, 2001. ,
Enzymes active in the areas undergoing cartilage resorption during the development of the secondary ossification center in the tibiae of rats ages 0-21 days: I. Two groups of proteinases cleave the core protein of aggrecan, Dev. Dyn, vol.222, pp.52-70, 2001. ,
FGF signaling in the developing endochondral skeleton, Cytokine Growth Factor Rev, vol.16, pp.205-213, 2005. ,
Advances in fibroblast growth factor signaling in growth plate development and disorders, J. Mol. Endocrinol, vol.53, pp.11-34, 2014. ,
Mutations in the gene encoding fibroblast growth factor receptor-3 in achondroplasia, Nature, vol.371, pp.252-254, 1994. ,
Interaction of FGF, Ihh/Pthlh, and BMP Signaling Integrates Chondrocyte Proliferation and Hypertrophic Differentiation, Dev. Cell, vol.3, pp.439-449, 2002. ,
Mechanisms underlying differential responses to FGF signaling, Cytokine Growth Factor Rev, vol.16, pp.233-247, 2005. ,
embryonic to in vitro cartilage development from mesenchymal stem cells, J. Tissue Eng. Regen. Med, vol.9, pp.332-342, 2015. ,
Deletion of Tgfbr2 in Prx1-cre expressing mesenchyme results in defects in development of the long bones and joints, Dev. Biol, vol.310, pp.304-316, 2007. ,
TGF-? signaling is essential for joint morphogenesis, J. Cell Biol, vol.177, pp.1105-1117, 2007. ,
Sox9 is required for cartilage formation, Nat. Genet, vol.22, pp.85-89, 1999. ,
SOX9 is a major negative regulator of cartilage vascularization, bone marrow formation and endochondral ossification, Development, vol.137, pp.901-911, 2010. ,
Control of chondrogenesis by the transcription factor Sox9, Mod. Rheumatol, vol.18, pp.213-219, 2008. ,
SOX9 directly regulates the type-II collagen gene, Nat. Genet, vol.16, pp.174-178, 1997. ,
Indian hedgehog signaling regulates proliferation and differentiation of chondrocytes and is essential for bone formation, Genes Dev, vol.13, pp.2072-2086, 1999. ,
PTHrP and Ihh in chondrocytes ,
Ihh signaling is directly required for the osteoblast lineage in the endochondral skeleton, Development, vol.131, pp.1309-1318, 2004. ,
Interactions between Sox9 and -catenin control chondrocyte differentiation, Genes Dev, vol.18, pp.1072-1087, 2004. ,
Targeted Disruption of Cbfa1 Results in a Complete Lack of Bone Formation owing to Maturational Arrest of Osteoblasts, Cell, vol.89, pp.755-764, 1997. ,
Runx2 and Runx3 are essential for chondrocyte maturation, and Runx2 regulates limb growth through induction of Indian hedgehog, Genes Dev, vol.18, pp.952-963, 2004. ,
Cbfa1, a Candidate Gene for Cleidocranial Dysplasia Syndrome, Is Essential for Osteoblast Differentiation and Bone Development, Cell, vol.89, pp.765-771, 1997. ,
Maturational disturbance of chondrocytes inCbfa1-deficient mice, Dev. Dyn, vol.214, pp.279-290, 1999. ,
The Fibroblast Growth Factor signaling pathway, Wiley Interdiscip. Rev. Dev. Biol, vol.4, pp.215-266, 2015. ,
A Lys644Glu substitution in fibroblast growth factor receptor 3 (FGFR3) causes dwarfism in mice by activation of STATs and ink4 cell cycle inhibitors, Hum. Mol. Genet, vol.8, pp.35-44, 1999. ,
Constitutive activation of MEK1 in chondrocytes causes Stat1-independent achondroplasia-like dwarfism and rescues the Fgfr3-deficient mouse phenotype, Genes Dev, vol.18, pp.290-305, 2004. ,
Bisindolylmaleimide I Suppresses Fibroblast Growth Factor-mediated Activation of Erk MAP Kinase in Chondrocytes by Preventing Shp2 Association with the Frs2 and Gab1 Adaptor Proteins, J. Biol. Chem, vol.282, pp.2929-2936, 2007. ,
Up-regulation of the chondrogenic Sox9 gene by fibroblast growth factors is mediated by the mitogenactivated protein kinase pathway, Proc. Natl. Acad. Sci, vol.97, pp.1113-1118, 2000. ,
A-Raf and B-Raf Are Dispensable for Normal Endochondral Bone Development, and Parathyroid Hormone-Related Peptide Suppresses Extracellular Signal-Regulated Kinase Activation in Hypertrophic Chondrocytes, Mol. Cell. Biol, vol.28, pp.344-357, 2008. ,
Raf signaling stimulates and represses the human collagen X promoter through distinguishable elements, J. Cell. Biochem, vol.72, pp.549-557, 1999. ,
Opposing Role of Mitogen-activated Protein Kinase Subtypes, Erk-1/2 and p38, in the Regulation of Chondrogenesis of Mesenchymes, J. Biol. Chem, vol.275, pp.5613-5619, 2000. ,
Sulfation of chondroitin sulfate proteoglycans is necessary for proper Indian hedgehog signaling in the developing growth plate, Development, vol.136, pp.1697-1706, 2009. ,
Ext1-Dependent Heparan Sulfate Regulates the Range of Ihh Signaling during Endochondral Ossification, Dev. Cell, vol.6, pp.801-813, 2004. ,
Functions of heparan sulfate proteoglycans in cell signaling during development, Development, vol.131, pp.6009-6021, 2004. ,
Cell surface, heparinlike molecules are required for binding of basic fibroblast growth factor to its high affinity receptor, Cell, vol.64, pp.841-848, 1991. ,
, Receptor Specificity of the Fibroblast Growth Factor Family, vol.7, 1996.
Receptor Specificity of the Fibroblast Growth Factor Family: THE COMPLETE MAMMALIAN FGF FAMILY, J. Biol. Chem, vol.281, pp.15694-15700, 2006. ,
FGFs, heparan sulfate and FGFRs: complex interactions essential for development, BioEssays, vol.22, pp.108-112, 2000. ,
Downregulation of Akt activity contributes to the growth arrest induced by FGF in chondrocytes, J. Cell. Physiol, vol.207, pp.800-808, 2006. ,
Akt signaling as a key regulatory pathway for chondrocyte terminal differentiation, Genes Cells, vol.13, pp.839-850, 2008. ,
Structure and expression of the membrane proteoglycan betaglycan, a component of the TGF-beta receptor system, Cell, vol.67, pp.785-795, 1991. ,
Expression cloning and characterization of the TGF-? type III receptor, Cell, vol.67, pp.797-805, 1991. ,